Phylogenetic Tree

It provides molecular evolutionary tree of the sequence queries.

>Sample1|Human|H3N2|HA CAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACATCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAGATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATGAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCACTCAGAGTGGGGGAAGCTATACTTGCAAAAGGGGATCTGTTAACAGTTTCTTCAGTAGATTGAATTGGTTGTACGAATCAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGAGAACAAACCAACCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAGAGAAGCCAGCAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTGTTGATTAATAGCACCGGGAACCTAATTGCTCCTCGGGGTTACTTCAAAATACGCACTGGGAAAAGCTCAATAATGAGGTCAGATGCACCTATTGGCACCTGCAGCTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCCTTTCAAAATGTAAACAAGATCACATATGGGGCATGTCCCAGGTATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGA >Sample2|Human|H3N2|HA CAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACATCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGAGTGGGGAAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACGAATCAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGAGAACAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACCGGGAACCTAATTGCTCCTCGGGGTTACTTCAAAATACGAACTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCACCTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATCCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCATGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGA >Sample3|Human|H3N2|HA CAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCAACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAAGAGCCAACAAACTGTAATCCCGAACATCGGGTCTAGACCCTGGGTAAGGGGTATCTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGAGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAGTTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGA